Latest Post


    Terimakasih Telah Berkunjung

    Desain Primer Menggunakan PerlPrimer

    Well, udah lama ga buka blog. Ada sedikit tips nih buat kalian yang ingin membuat Primer DNA suatu bakteri atau DNA apapun dengan menggunakan software Perl Primer. Sebenarnya tips ini sudah ada di sciencebiotech.net tapi kami disini melengkapi yang belum lengkap
    1. Langkah pertama yang harus kalian lakukan adalah punya software PerlPrimer. Bisa di download di http://perlprimer.sourceforge.net/download.html
    2. Silahkan install software PerlPrimer di komputermu, seperti kalian biasa menginstal software lainnya.
    3. Buka software PerlPrimer yang teah terinstal. Berikut penampakannya


    4. Cari CDS (Code DNA Sequence) di website ncbi. Pada kali ini digunakan gen urea H. pylori, di http://www.ncbi.nlm.nih.gov/nuccore/14583072?report=fasta yang memiliki panjang 717 pasangan basa 
    ATGAAACTCACCCCAAAAGAGTTAGATAAGTTGATGCTCCACTATGCTGGAGAATTGGCTAGGAAACGCA
    AAGAAAAAGGCATTAAGCTTAACTATGTGGAAGCAGTAGCTTTGATTAGTGCCCATATTATGGAAGAAGC
    GAGAGCTGGTAAGAAAAGTGCGGCTGAATTGATGCAAGAAGGGCGCACTCTTTTAAAACCTGATGATGTG
    ATGGATGGCGTGGCAAGCATGATCCATGAAGTGGGTATTGAAGCGATGTTTCCTGATGGGACCAAACTCG
    TAACCGTGCATACCCCTATTGAGGCTAATGGTAAATTAGTTCCTGGTGAGTTGTTCTTAAAAAATGAAGA
    CATCACTATCAACGAAGGCAAAAAAGCCGTTAGCGTGAAAGTTAAAAATGTTGGCGACAGACCGGTTCAA
    ATCGGCTCACACTTCCATTTCTTTGAAGTGAATAGATACTTAGACTTTGACAGAGAAAAAACTTTCGGCA
    AACGCTTGGATATTGCGAGCGGGACAGCAGTAAGGTTTGAACCTGGCGAAGAAAAATCTGTAGAATTGAT
    TGACATCGGCGGCAACAGAAGAATCTTTGGATTTAACGCATTGGTTGATAGGCAAGCAGATAACGAAAGC
    AAAAAAATTGCTTTACACAGAGCTAAAGAGCGTGGTTTTCATGGCGCTAAAAGCGATGACAACTATGTAA
    AAACAATTAAGGAGTAA
    5. Copy dan Paste sekuens tersebut di kolom Sequence Kalian bisa atur Primer Tm (titik leleh) di default, Primer Length (Panjang Primer) default pada 20-24, Amplified range, pada 5' 1-100 dan 3' 600-717. Klik tombol Find Primer


    6. Double Klik salah satu hasil primer. Akan muncul halaman baru di tab Primer dengan hasil Primer Dimer


    7. Hasil yang baik adalah apabila tidak terbentuk ikatan sesama primer, baik antar Primer Forward dan Reverse, Forward dengan Forward, ataupun Reverse dengan Reverse. Ikatan ditandai dengan garis |
    antara primer
    8. Untuk memastikan spesifitas kode gen bakteri yang kita deteksi, klik BLAST primer. Atau, bisa juga buka di situs  ncbi, http://blast.ncbi.nlm.nih.gov/Blast.cgi
    9. Pada tutorial ini, kami melakukan langkah ke-2, yaitu melalui situs ncbi. Pada halaman yang muncul, pilih nucleotide blast
    10. Masukkan sequence Primer Forward pada kotak yang tersedia, klik BLAST
    11. Apabila pada list di bawah terdaftar bakteri kita, menandakan bahwa gen bakteri kita sesuai dengan harapan.


    0 komentar:

    Post a Comment